ID: 1164393799

View in Genome Browser
Species Human (GRCh38)
Location 19:27846797-27846819
Sequence TCTGGACAAACAGATACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164393794_1164393799 28 Left 1164393794 19:27846746-27846768 CCAGCTTTGTTATGCGAGGTTAA No data
Right 1164393799 19:27846797-27846819 TCTGGACAAACAGATACTGGAGG No data
1164393796_1164393799 -7 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393799 19:27846797-27846819 TCTGGACAAACAGATACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164393799 Original CRISPR TCTGGACAAACAGATACTGG AGG Intergenic
No off target data available for this crispr