ID: 1164393804 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:27846815-27846837 |
| Sequence | GGAGGGCTCAGTGAAGGCAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164393797_1164393804 | 5 | Left | 1164393797 | 19:27846787-27846809 | CCTATAACTGTCTGGACAAACAG | No data | ||
| Right | 1164393804 | 19:27846815-27846837 | GGAGGGCTCAGTGAAGGCAGGGG | No data | ||||
| 1164393796_1164393804 | 11 | Left | 1164393796 | 19:27846781-27846803 | CCGCATCCTATAACTGTCTGGAC | No data | ||
| Right | 1164393804 | 19:27846815-27846837 | GGAGGGCTCAGTGAAGGCAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164393804 | Original CRISPR | GGAGGGCTCAGTGAAGGCAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||