ID: 1164393804

View in Genome Browser
Species Human (GRCh38)
Location 19:27846815-27846837
Sequence GGAGGGCTCAGTGAAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164393797_1164393804 5 Left 1164393797 19:27846787-27846809 CCTATAACTGTCTGGACAAACAG No data
Right 1164393804 19:27846815-27846837 GGAGGGCTCAGTGAAGGCAGGGG No data
1164393796_1164393804 11 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393804 19:27846815-27846837 GGAGGGCTCAGTGAAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164393804 Original CRISPR GGAGGGCTCAGTGAAGGCAG GGG Intergenic
No off target data available for this crispr