ID: 1164393806

View in Genome Browser
Species Human (GRCh38)
Location 19:27846833-27846855
Sequence AGGGGTTTGTCTTTTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164393796_1164393806 29 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393806 19:27846833-27846855 AGGGGTTTGTCTTTTGCCCTGGG No data
1164393797_1164393806 23 Left 1164393797 19:27846787-27846809 CCTATAACTGTCTGGACAAACAG No data
Right 1164393806 19:27846833-27846855 AGGGGTTTGTCTTTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164393806 Original CRISPR AGGGGTTTGTCTTTTGCCCT GGG Intergenic
No off target data available for this crispr