ID: 1164398164

View in Genome Browser
Species Human (GRCh38)
Location 19:27884233-27884255
Sequence GCCCCTATTATGTGTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164398160_1164398164 -8 Left 1164398160 19:27884218-27884240 CCTTATCCCAAGGATGCCCCTAT No data
Right 1164398164 19:27884233-27884255 GCCCCTATTATGTGTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164398164 Original CRISPR GCCCCTATTATGTGTAAGGA AGG Intergenic
No off target data available for this crispr