ID: 1164398221

View in Genome Browser
Species Human (GRCh38)
Location 19:27884762-27884784
Sequence GTGCTGTTACTGAGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164398221_1164398229 26 Left 1164398221 19:27884762-27884784 CCCTTTATCCTCAGTAACAGCAC No data
Right 1164398229 19:27884811-27884833 ACAGCTGAAGTAGGAAGTACTGG No data
1164398221_1164398227 17 Left 1164398221 19:27884762-27884784 CCCTTTATCCTCAGTAACAGCAC No data
Right 1164398227 19:27884802-27884824 GATGTCCTCACAGCTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164398221 Original CRISPR GTGCTGTTACTGAGGATAAA GGG (reversed) Intergenic
No off target data available for this crispr