ID: 1164402214

View in Genome Browser
Species Human (GRCh38)
Location 19:27910108-27910130
Sequence TGCGGGATGTTGCACTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164402214_1164402222 15 Left 1164402214 19:27910108-27910130 CCCAGGTAGTGCAACATCCCGCA No data
Right 1164402222 19:27910146-27910168 CCCGCAAGTTCCGGCCTCCAAGG No data
1164402214_1164402224 18 Left 1164402214 19:27910108-27910130 CCCAGGTAGTGCAACATCCCGCA No data
Right 1164402224 19:27910149-27910171 GCAAGTTCCGGCCTCCAAGGAGG No data
1164402214_1164402227 28 Left 1164402214 19:27910108-27910130 CCCAGGTAGTGCAACATCCCGCA No data
Right 1164402227 19:27910159-27910181 GCCTCCAAGGAGGACGCTGGCGG No data
1164402214_1164402229 29 Left 1164402214 19:27910108-27910130 CCCAGGTAGTGCAACATCCCGCA No data
Right 1164402229 19:27910160-27910182 CCTCCAAGGAGGACGCTGGCGGG No data
1164402214_1164402219 6 Left 1164402214 19:27910108-27910130 CCCAGGTAGTGCAACATCCCGCA No data
Right 1164402219 19:27910137-27910159 TCCTTAGCGCCCGCAAGTTCCGG No data
1164402214_1164402226 25 Left 1164402214 19:27910108-27910130 CCCAGGTAGTGCAACATCCCGCA No data
Right 1164402226 19:27910156-27910178 CCGGCCTCCAAGGAGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164402214 Original CRISPR TGCGGGATGTTGCACTACCT GGG (reversed) Intergenic
No off target data available for this crispr