ID: 1164402304

View in Genome Browser
Species Human (GRCh38)
Location 19:27910669-27910691
Sequence TAGCATCGCTCTGCTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164402293_1164402304 22 Left 1164402293 19:27910624-27910646 CCTATGGCAACAGGAGGTTGGTT No data
Right 1164402304 19:27910669-27910691 TAGCATCGCTCTGCTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164402304 Original CRISPR TAGCATCGCTCTGCTGGTGG TGG Intergenic
No off target data available for this crispr