ID: 1164403028

View in Genome Browser
Species Human (GRCh38)
Location 19:27915534-27915556
Sequence CTTCCATCACTTTTACAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164403026_1164403028 -4 Left 1164403026 19:27915515-27915537 CCGATAACCATCTCTTGGTCTTC No data
Right 1164403028 19:27915534-27915556 CTTCCATCACTTTTACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164403028 Original CRISPR CTTCCATCACTTTTACAATA TGG Intergenic
No off target data available for this crispr