ID: 1164405483

View in Genome Browser
Species Human (GRCh38)
Location 19:27941718-27941740
Sequence AACTGCTCGCATGTCACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164405483_1164405487 3 Left 1164405483 19:27941718-27941740 CCTTAGGTGACATGCGAGCAGTT No data
Right 1164405487 19:27941744-27941766 AAAGTGAGGGGAAACTTGTGAGG No data
1164405483_1164405488 9 Left 1164405483 19:27941718-27941740 CCTTAGGTGACATGCGAGCAGTT No data
Right 1164405488 19:27941750-27941772 AGGGGAAACTTGTGAGGATGTGG No data
1164405483_1164405485 -10 Left 1164405483 19:27941718-27941740 CCTTAGGTGACATGCGAGCAGTT No data
Right 1164405485 19:27941731-27941753 GCGAGCAGTTCTAAAAGTGAGGG No data
1164405483_1164405489 27 Left 1164405483 19:27941718-27941740 CCTTAGGTGACATGCGAGCAGTT No data
Right 1164405489 19:27941768-27941790 TGTGGAGAGCTTCCACACAGAGG No data
1164405483_1164405486 -9 Left 1164405483 19:27941718-27941740 CCTTAGGTGACATGCGAGCAGTT No data
Right 1164405486 19:27941732-27941754 CGAGCAGTTCTAAAAGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164405483 Original CRISPR AACTGCTCGCATGTCACCTA AGG (reversed) Intergenic