ID: 1164405485 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:27941731-27941753 |
Sequence | GCGAGCAGTTCTAAAAGTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164405483_1164405485 | -10 | Left | 1164405483 | 19:27941718-27941740 | CCTTAGGTGACATGCGAGCAGTT | No data | ||
Right | 1164405485 | 19:27941731-27941753 | GCGAGCAGTTCTAAAAGTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164405485 | Original CRISPR | GCGAGCAGTTCTAAAAGTGA GGG | Intergenic | ||