ID: 1164405485

View in Genome Browser
Species Human (GRCh38)
Location 19:27941731-27941753
Sequence GCGAGCAGTTCTAAAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164405483_1164405485 -10 Left 1164405483 19:27941718-27941740 CCTTAGGTGACATGCGAGCAGTT No data
Right 1164405485 19:27941731-27941753 GCGAGCAGTTCTAAAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164405485 Original CRISPR GCGAGCAGTTCTAAAAGTGA GGG Intergenic