ID: 1164408366

View in Genome Browser
Species Human (GRCh38)
Location 19:27975408-27975430
Sequence TGCAACACTCCTAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164408366_1164408373 28 Left 1164408366 19:27975408-27975430 CCCTCCCCATTAGGAGTGTTGCA No data
Right 1164408373 19:27975459-27975481 GCTGCTCCAGTGTTTCCTTGAGG No data
1164408366_1164408372 -6 Left 1164408366 19:27975408-27975430 CCCTCCCCATTAGGAGTGTTGCA No data
Right 1164408372 19:27975425-27975447 GTTGCATGTGTTTAGAAATTGGG No data
1164408366_1164408371 -7 Left 1164408366 19:27975408-27975430 CCCTCCCCATTAGGAGTGTTGCA No data
Right 1164408371 19:27975424-27975446 TGTTGCATGTGTTTAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164408366 Original CRISPR TGCAACACTCCTAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr