ID: 1164411402

View in Genome Browser
Species Human (GRCh38)
Location 19:28008828-28008850
Sequence CAGTATGCAAAGAGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164411392_1164411402 17 Left 1164411392 19:28008788-28008810 CCACCCACCCAGAAGATCAGCTG No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data
1164411396_1164411402 10 Left 1164411396 19:28008795-28008817 CCCAGAAGATCAGCTGGCTTTAC No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data
1164411395_1164411402 13 Left 1164411395 19:28008792-28008814 CCACCCAGAAGATCAGCTGGCTT No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data
1164411394_1164411402 14 Left 1164411394 19:28008791-28008813 CCCACCCAGAAGATCAGCTGGCT No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data
1164411390_1164411402 19 Left 1164411390 19:28008786-28008808 CCCCACCCACCCAGAAGATCAGC No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data
1164411391_1164411402 18 Left 1164411391 19:28008787-28008809 CCCACCCACCCAGAAGATCAGCT No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data
1164411397_1164411402 9 Left 1164411397 19:28008796-28008818 CCAGAAGATCAGCTGGCTTTACC No data
Right 1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164411402 Original CRISPR CAGTATGCAAAGAGCCAGCA GGG Intergenic
No off target data available for this crispr