ID: 1164411818

View in Genome Browser
Species Human (GRCh38)
Location 19:28012551-28012573
Sequence TACAATGCACAGAGGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164411818_1164411827 20 Left 1164411818 19:28012551-28012573 CCCCGCTCCCTCTGTGCATTGTA No data
Right 1164411827 19:28012594-28012616 ACACTCTAGGGCTACTCACAAGG No data
1164411818_1164411825 8 Left 1164411818 19:28012551-28012573 CCCCGCTCCCTCTGTGCATTGTA No data
Right 1164411825 19:28012582-28012604 GTGGATTCTACCACACTCTAGGG No data
1164411818_1164411824 7 Left 1164411818 19:28012551-28012573 CCCCGCTCCCTCTGTGCATTGTA No data
Right 1164411824 19:28012581-28012603 TGTGGATTCTACCACACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164411818 Original CRISPR TACAATGCACAGAGGGAGCG GGG (reversed) Intergenic
No off target data available for this crispr