ID: 1164413315

View in Genome Browser
Species Human (GRCh38)
Location 19:28023299-28023321
Sequence TGGCACCTGCACAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164413315_1164413317 -7 Left 1164413315 19:28023299-28023321 CCATTCTCATTGTGCAGGTGCCA No data
Right 1164413317 19:28023315-28023337 GGTGCCAAAGCTGAGGCCAGAGG No data
1164413315_1164413318 -6 Left 1164413315 19:28023299-28023321 CCATTCTCATTGTGCAGGTGCCA No data
Right 1164413318 19:28023316-28023338 GTGCCAAAGCTGAGGCCAGAGGG No data
1164413315_1164413320 0 Left 1164413315 19:28023299-28023321 CCATTCTCATTGTGCAGGTGCCA No data
Right 1164413320 19:28023322-28023344 AAGCTGAGGCCAGAGGGATTAGG No data
1164413315_1164413321 6 Left 1164413315 19:28023299-28023321 CCATTCTCATTGTGCAGGTGCCA No data
Right 1164413321 19:28023328-28023350 AGGCCAGAGGGATTAGGAGATGG No data
1164413315_1164413323 19 Left 1164413315 19:28023299-28023321 CCATTCTCATTGTGCAGGTGCCA No data
Right 1164413323 19:28023341-28023363 TAGGAGATGGTATATGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164413315 Original CRISPR TGGCACCTGCACAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr