ID: 1164415835

View in Genome Browser
Species Human (GRCh38)
Location 19:28045913-28045935
Sequence TGAGAATAGCTATGAACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164415835_1164415839 6 Left 1164415835 19:28045913-28045935 CCAGTTGTTCATAGCTATTCTCA No data
Right 1164415839 19:28045942-28045964 TCAGCCCAGGTATTCACAGCTGG No data
1164415835_1164415842 12 Left 1164415835 19:28045913-28045935 CCAGTTGTTCATAGCTATTCTCA No data
Right 1164415842 19:28045948-28045970 CAGGTATTCACAGCTGGCCATGG No data
1164415835_1164415838 -7 Left 1164415835 19:28045913-28045935 CCAGTTGTTCATAGCTATTCTCA No data
Right 1164415838 19:28045929-28045951 ATTCTCATCAGGGTCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164415835 Original CRISPR TGAGAATAGCTATGAACAAC TGG (reversed) Intergenic
No off target data available for this crispr