ID: 1164417304

View in Genome Browser
Species Human (GRCh38)
Location 19:28057889-28057911
Sequence GGGTTCATAGCTCTCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164417304_1164417313 30 Left 1164417304 19:28057889-28057911 CCAGTGAGGAGAGCTATGAACCC No data
Right 1164417313 19:28057942-28057964 AACCTGGGCTTTGCCCAGAGAGG No data
1164417304_1164417312 15 Left 1164417304 19:28057889-28057911 CCAGTGAGGAGAGCTATGAACCC No data
Right 1164417312 19:28057927-28057949 GAGAATGTCTATGAAAACCTGGG No data
1164417304_1164417311 14 Left 1164417304 19:28057889-28057911 CCAGTGAGGAGAGCTATGAACCC No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164417304 Original CRISPR GGGTTCATAGCTCTCCTCAC TGG (reversed) Intergenic
No off target data available for this crispr