ID: 1164417309

View in Genome Browser
Species Human (GRCh38)
Location 19:28057911-28057933
Sequence CATTCTCATTGTGCCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164417309_1164417318 26 Left 1164417309 19:28057911-28057933 CCTGGCCTGGCACAATGAGAATG No data
Right 1164417318 19:28057960-28057982 AGAGGACGGCTGTGAAAACCTGG No data
1164417309_1164417312 -7 Left 1164417309 19:28057911-28057933 CCTGGCCTGGCACAATGAGAATG No data
Right 1164417312 19:28057927-28057949 GAGAATGTCTATGAAAACCTGGG No data
1164417309_1164417313 8 Left 1164417309 19:28057911-28057933 CCTGGCCTGGCACAATGAGAATG No data
Right 1164417313 19:28057942-28057964 AACCTGGGCTTTGCCCAGAGAGG No data
1164417309_1164417315 12 Left 1164417309 19:28057911-28057933 CCTGGCCTGGCACAATGAGAATG No data
Right 1164417315 19:28057946-28057968 TGGGCTTTGCCCAGAGAGGACGG No data
1164417309_1164417311 -8 Left 1164417309 19:28057911-28057933 CCTGGCCTGGCACAATGAGAATG No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164417309 Original CRISPR CATTCTCATTGTGCCAGGCC AGG (reversed) Intergenic
No off target data available for this crispr