ID: 1164417311

View in Genome Browser
Species Human (GRCh38)
Location 19:28057926-28057948
Sequence TGAGAATGTCTATGAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164417308_1164417311 -7 Left 1164417308 19:28057910-28057932 CCCTGGCCTGGCACAATGAGAAT No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data
1164417303_1164417311 15 Left 1164417303 19:28057888-28057910 CCCAGTGAGGAGAGCTATGAACC No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data
1164417307_1164417311 -6 Left 1164417307 19:28057909-28057931 CCCCTGGCCTGGCACAATGAGAA No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data
1164417304_1164417311 14 Left 1164417304 19:28057889-28057911 CCAGTGAGGAGAGCTATGAACCC No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data
1164417309_1164417311 -8 Left 1164417309 19:28057911-28057933 CCTGGCCTGGCACAATGAGAATG No data
Right 1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164417311 Original CRISPR TGAGAATGTCTATGAAAACC TGG Intergenic
No off target data available for this crispr