ID: 1164417835

View in Genome Browser
Species Human (GRCh38)
Location 19:28061070-28061092
Sequence TAAGAATCGCTATGAATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164417835_1164417840 15 Left 1164417835 19:28061070-28061092 CCAGGTATTCATAGCGATTCTTA No data
Right 1164417840 19:28061108-28061130 GTGTTTACAGACCTCCTCATTGG No data
1164417835_1164417841 16 Left 1164417835 19:28061070-28061092 CCAGGTATTCATAGCGATTCTTA No data
Right 1164417841 19:28061109-28061131 TGTTTACAGACCTCCTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164417835 Original CRISPR TAAGAATCGCTATGAATACC TGG (reversed) Intergenic
No off target data available for this crispr