ID: 1164422102

View in Genome Browser
Species Human (GRCh38)
Location 19:28103446-28103468
Sequence ATGTCCTTCTAGAGCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164422101_1164422102 2 Left 1164422101 19:28103421-28103443 CCACAAGGATCTCAGCTAATCTC No data
Right 1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG No data
1164422100_1164422102 8 Left 1164422100 19:28103415-28103437 CCTCAGCCACAAGGATCTCAGCT No data
Right 1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164422102 Original CRISPR ATGTCCTTCTAGAGCTGAGA TGG Intergenic
No off target data available for this crispr