ID: 1164422102 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:28103446-28103468 |
Sequence | ATGTCCTTCTAGAGCTGAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164422101_1164422102 | 2 | Left | 1164422101 | 19:28103421-28103443 | CCACAAGGATCTCAGCTAATCTC | No data | ||
Right | 1164422102 | 19:28103446-28103468 | ATGTCCTTCTAGAGCTGAGATGG | No data | ||||
1164422100_1164422102 | 8 | Left | 1164422100 | 19:28103415-28103437 | CCTCAGCCACAAGGATCTCAGCT | No data | ||
Right | 1164422102 | 19:28103446-28103468 | ATGTCCTTCTAGAGCTGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164422102 | Original CRISPR | ATGTCCTTCTAGAGCTGAGA TGG | Intergenic | ||
No off target data available for this crispr |