ID: 1164423164

View in Genome Browser
Species Human (GRCh38)
Location 19:28115545-28115567
Sequence TATAAAAAGGATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164423164_1164423169 24 Left 1164423164 19:28115545-28115567 CCTTCCTCCTCATCCTTTTTATA No data
Right 1164423169 19:28115592-28115614 TATAATTCCTTATGCTATGAGGG No data
1164423164_1164423168 23 Left 1164423164 19:28115545-28115567 CCTTCCTCCTCATCCTTTTTATA No data
Right 1164423168 19:28115591-28115613 GTATAATTCCTTATGCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164423164 Original CRISPR TATAAAAAGGATGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr