ID: 1164423627

View in Genome Browser
Species Human (GRCh38)
Location 19:28119876-28119898
Sequence TAGGAAACCCAAGCAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164423627_1164423634 22 Left 1164423627 19:28119876-28119898 CCTTGATCTGCTTGGGTTTCCTA No data
Right 1164423634 19:28119921-28119943 ACTCCTCCAGAAAAAAAGCTGGG No data
1164423627_1164423638 29 Left 1164423627 19:28119876-28119898 CCTTGATCTGCTTGGGTTTCCTA No data
Right 1164423638 19:28119928-28119950 CAGAAAAAAAGCTGGGGCATAGG No data
1164423627_1164423629 -4 Left 1164423627 19:28119876-28119898 CCTTGATCTGCTTGGGTTTCCTA No data
Right 1164423629 19:28119895-28119917 CCTATCCCTACACTGTCCTCTGG No data
1164423627_1164423633 21 Left 1164423627 19:28119876-28119898 CCTTGATCTGCTTGGGTTTCCTA No data
Right 1164423633 19:28119920-28119942 AACTCCTCCAGAAAAAAAGCTGG No data
1164423627_1164423639 30 Left 1164423627 19:28119876-28119898 CCTTGATCTGCTTGGGTTTCCTA No data
Right 1164423639 19:28119929-28119951 AGAAAAAAAGCTGGGGCATAGGG No data
1164423627_1164423635 23 Left 1164423627 19:28119876-28119898 CCTTGATCTGCTTGGGTTTCCTA No data
Right 1164423635 19:28119922-28119944 CTCCTCCAGAAAAAAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164423627 Original CRISPR TAGGAAACCCAAGCAGATCA AGG (reversed) Intergenic
No off target data available for this crispr