ID: 1164424057

View in Genome Browser
Species Human (GRCh38)
Location 19:28124528-28124550
Sequence CTGTCCAGACAGATGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164424057_1164424059 -1 Left 1164424057 19:28124528-28124550 CCTTGCTGCATCTGTCTGGACAG No data
Right 1164424059 19:28124550-28124572 GACGTGATGCCCTTGACTGTGGG No data
1164424057_1164424058 -2 Left 1164424057 19:28124528-28124550 CCTTGCTGCATCTGTCTGGACAG No data
Right 1164424058 19:28124549-28124571 AGACGTGATGCCCTTGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164424057 Original CRISPR CTGTCCAGACAGATGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr