ID: 1164424058

View in Genome Browser
Species Human (GRCh38)
Location 19:28124549-28124571
Sequence AGACGTGATGCCCTTGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164424053_1164424058 19 Left 1164424053 19:28124507-28124529 CCCCTTCTACATGAGTGTGGGCC No data
Right 1164424058 19:28124549-28124571 AGACGTGATGCCCTTGACTGTGG No data
1164424057_1164424058 -2 Left 1164424057 19:28124528-28124550 CCTTGCTGCATCTGTCTGGACAG No data
Right 1164424058 19:28124549-28124571 AGACGTGATGCCCTTGACTGTGG No data
1164424055_1164424058 17 Left 1164424055 19:28124509-28124531 CCTTCTACATGAGTGTGGGCCTT No data
Right 1164424058 19:28124549-28124571 AGACGTGATGCCCTTGACTGTGG No data
1164424054_1164424058 18 Left 1164424054 19:28124508-28124530 CCCTTCTACATGAGTGTGGGCCT No data
Right 1164424058 19:28124549-28124571 AGACGTGATGCCCTTGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164424058 Original CRISPR AGACGTGATGCCCTTGACTG TGG Intergenic
No off target data available for this crispr