ID: 1164432014

View in Genome Browser
Species Human (GRCh38)
Location 19:28197114-28197136
Sequence GCACAGCTGGTCATTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164432014_1164432020 -8 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432020 19:28197129-28197151 AGCTGTGCATCATGGGGAAAGGG No data
1164432014_1164432022 1 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432022 19:28197138-28197160 TCATGGGGAAAGGGCGGCAGTGG No data
1164432014_1164432019 -9 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432019 19:28197128-28197150 CAGCTGTGCATCATGGGGAAAGG No data
1164432014_1164432026 30 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432026 19:28197167-28197189 GCCCAGGACAGCTCTACTTAAGG No data
1164432014_1164432023 2 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432023 19:28197139-28197161 CATGGGGAAAGGGCGGCAGTGGG No data
1164432014_1164432025 14 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432025 19:28197151-28197173 GCGGCAGTGGGCAGAGGCCCAGG No data
1164432014_1164432024 8 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432024 19:28197145-28197167 GAAAGGGCGGCAGTGGGCAGAGG No data
1164432014_1164432021 -5 Left 1164432014 19:28197114-28197136 CCTCAAGGAATGACCAGCTGTGC No data
Right 1164432021 19:28197132-28197154 TGTGCATCATGGGGAAAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164432014 Original CRISPR GCACAGCTGGTCATTCCTTG AGG (reversed) Intergenic
No off target data available for this crispr