ID: 1164436758

View in Genome Browser
Species Human (GRCh38)
Location 19:28237123-28237145
Sequence ATTATGGAGAAGATTGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164436758_1164436763 22 Left 1164436758 19:28237123-28237145 CCTCATTCAATCTTCTCCATAAT No data
Right 1164436763 19:28237168-28237190 CCTACTCTGTAGATGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164436758 Original CRISPR ATTATGGAGAAGATTGAATG AGG (reversed) Intergenic
No off target data available for this crispr