ID: 1164442696

View in Genome Browser
Species Human (GRCh38)
Location 19:28291431-28291453
Sequence CTCAGCAGGGCCTCTTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164442696_1164442699 -5 Left 1164442696 19:28291431-28291453 CCTCACAAAGAGGCCCTGCTGAG No data
Right 1164442699 19:28291449-28291471 CTGAGCAGTTCAGTTTCCAGTGG No data
1164442696_1164442701 13 Left 1164442696 19:28291431-28291453 CCTCACAAAGAGGCCCTGCTGAG No data
Right 1164442701 19:28291467-28291489 AGTGGTGCAAATAAATAAAGTGG No data
1164442696_1164442702 17 Left 1164442696 19:28291431-28291453 CCTCACAAAGAGGCCCTGCTGAG No data
Right 1164442702 19:28291471-28291493 GTGCAAATAAATAAAGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164442696 Original CRISPR CTCAGCAGGGCCTCTTTGTG AGG (reversed) Intergenic
No off target data available for this crispr