ID: 1164443850

View in Genome Browser
Species Human (GRCh38)
Location 19:28300544-28300566
Sequence CTGGAGACTCAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164443840_1164443850 22 Left 1164443840 19:28300499-28300521 CCAAGCTATGGGTATGCAAAGTC No data
Right 1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164443850 Original CRISPR CTGGAGACTCAGAAGGGGGA AGG Intergenic
No off target data available for this crispr