ID: 1164453351

View in Genome Browser
Species Human (GRCh38)
Location 19:28385839-28385861
Sequence CTGCTGTTCTTGAATAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164453351_1164453356 8 Left 1164453351 19:28385839-28385861 CCATGTTTATTCAAGAACAGCAG No data
Right 1164453356 19:28385870-28385892 TGGTAGGTCGGTGAGCTTTGTGG No data
1164453351_1164453354 -8 Left 1164453351 19:28385839-28385861 CCATGTTTATTCAAGAACAGCAG No data
Right 1164453354 19:28385854-28385876 AACAGCAGGTGAGTCTTGGTAGG No data
1164453351_1164453355 -4 Left 1164453351 19:28385839-28385861 CCATGTTTATTCAAGAACAGCAG No data
Right 1164453355 19:28385858-28385880 GCAGGTGAGTCTTGGTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164453351 Original CRISPR CTGCTGTTCTTGAATAAACA TGG (reversed) Intergenic
No off target data available for this crispr