ID: 1164460755

View in Genome Browser
Species Human (GRCh38)
Location 19:28445621-28445643
Sequence CAGTTTCACCAGAGTGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164460755_1164460765 29 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460765 19:28445673-28445695 CCGCCGCCCAGTTCGGGTGAGGG No data
1164460755_1164460763 28 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460763 19:28445672-28445694 GCCGCCGCCCAGTTCGGGTGAGG No data
1164460755_1164460761 22 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460761 19:28445666-28445688 CTTACTGCCGCCGCCCAGTTCGG No data
1164460755_1164460762 23 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460762 19:28445667-28445689 TTACTGCCGCCGCCCAGTTCGGG No data
1164460755_1164460758 -7 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460758 19:28445637-28445659 GAAACTGAAAGGTTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164460755 Original CRISPR CAGTTTCACCAGAGTGGCGC TGG (reversed) Intergenic
No off target data available for this crispr