ID: 1164460757

View in Genome Browser
Species Human (GRCh38)
Location 19:28445627-28445649
Sequence ACCTTTCAGTTTCACCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164460757_1164460761 16 Left 1164460757 19:28445627-28445649 CCACTCTGGTGAAACTGAAAGGT No data
Right 1164460761 19:28445666-28445688 CTTACTGCCGCCGCCCAGTTCGG No data
1164460757_1164460765 23 Left 1164460757 19:28445627-28445649 CCACTCTGGTGAAACTGAAAGGT No data
Right 1164460765 19:28445673-28445695 CCGCCGCCCAGTTCGGGTGAGGG No data
1164460757_1164460762 17 Left 1164460757 19:28445627-28445649 CCACTCTGGTGAAACTGAAAGGT No data
Right 1164460762 19:28445667-28445689 TTACTGCCGCCGCCCAGTTCGGG No data
1164460757_1164460763 22 Left 1164460757 19:28445627-28445649 CCACTCTGGTGAAACTGAAAGGT No data
Right 1164460763 19:28445672-28445694 GCCGCCGCCCAGTTCGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164460757 Original CRISPR ACCTTTCAGTTTCACCAGAG TGG (reversed) Intergenic
No off target data available for this crispr