ID: 1164460758

View in Genome Browser
Species Human (GRCh38)
Location 19:28445637-28445659
Sequence GAAACTGAAAGGTTTCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164460752_1164460758 24 Left 1164460752 19:28445590-28445612 CCTAAGCATGGAGACAACTGCAA No data
Right 1164460758 19:28445637-28445659 GAAACTGAAAGGTTTCCACATGG No data
1164460755_1164460758 -7 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460758 19:28445637-28445659 GAAACTGAAAGGTTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164460758 Original CRISPR GAAACTGAAAGGTTTCCACA TGG Intergenic
No off target data available for this crispr