ID: 1164460758 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:28445637-28445659 |
Sequence | GAAACTGAAAGGTTTCCACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164460752_1164460758 | 24 | Left | 1164460752 | 19:28445590-28445612 | CCTAAGCATGGAGACAACTGCAA | No data | ||
Right | 1164460758 | 19:28445637-28445659 | GAAACTGAAAGGTTTCCACATGG | No data | ||||
1164460755_1164460758 | -7 | Left | 1164460755 | 19:28445621-28445643 | CCAGCGCCACTCTGGTGAAACTG | No data | ||
Right | 1164460758 | 19:28445637-28445659 | GAAACTGAAAGGTTTCCACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164460758 | Original CRISPR | GAAACTGAAAGGTTTCCACA TGG | Intergenic | ||
No off target data available for this crispr |