ID: 1164460759

View in Genome Browser
Species Human (GRCh38)
Location 19:28445652-28445674
Sequence GGCAGTAAGGCGCTTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164460759_1164460765 -2 Left 1164460759 19:28445652-28445674 CCACATGGAAGCGCCTTACTGCC No data
Right 1164460765 19:28445673-28445695 CCGCCGCCCAGTTCGGGTGAGGG No data
1164460759_1164460763 -3 Left 1164460759 19:28445652-28445674 CCACATGGAAGCGCCTTACTGCC No data
Right 1164460763 19:28445672-28445694 GCCGCCGCCCAGTTCGGGTGAGG No data
1164460759_1164460761 -9 Left 1164460759 19:28445652-28445674 CCACATGGAAGCGCCTTACTGCC No data
Right 1164460761 19:28445666-28445688 CTTACTGCCGCCGCCCAGTTCGG No data
1164460759_1164460762 -8 Left 1164460759 19:28445652-28445674 CCACATGGAAGCGCCTTACTGCC No data
Right 1164460762 19:28445667-28445689 TTACTGCCGCCGCCCAGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164460759 Original CRISPR GGCAGTAAGGCGCTTCCATG TGG (reversed) Intergenic
No off target data available for this crispr