ID: 1164460763

View in Genome Browser
Species Human (GRCh38)
Location 19:28445672-28445694
Sequence GCCGCCGCCCAGTTCGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164460759_1164460763 -3 Left 1164460759 19:28445652-28445674 CCACATGGAAGCGCCTTACTGCC No data
Right 1164460763 19:28445672-28445694 GCCGCCGCCCAGTTCGGGTGAGG No data
1164460757_1164460763 22 Left 1164460757 19:28445627-28445649 CCACTCTGGTGAAACTGAAAGGT No data
Right 1164460763 19:28445672-28445694 GCCGCCGCCCAGTTCGGGTGAGG No data
1164460755_1164460763 28 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460763 19:28445672-28445694 GCCGCCGCCCAGTTCGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164460763 Original CRISPR GCCGCCGCCCAGTTCGGGTG AGG Intergenic
No off target data available for this crispr