ID: 1164460765

View in Genome Browser
Species Human (GRCh38)
Location 19:28445673-28445695
Sequence CCGCCGCCCAGTTCGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164460755_1164460765 29 Left 1164460755 19:28445621-28445643 CCAGCGCCACTCTGGTGAAACTG No data
Right 1164460765 19:28445673-28445695 CCGCCGCCCAGTTCGGGTGAGGG No data
1164460759_1164460765 -2 Left 1164460759 19:28445652-28445674 CCACATGGAAGCGCCTTACTGCC No data
Right 1164460765 19:28445673-28445695 CCGCCGCCCAGTTCGGGTGAGGG No data
1164460757_1164460765 23 Left 1164460757 19:28445627-28445649 CCACTCTGGTGAAACTGAAAGGT No data
Right 1164460765 19:28445673-28445695 CCGCCGCCCAGTTCGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164460765 Original CRISPR CCGCCGCCCAGTTCGGGTGA GGG Intergenic
No off target data available for this crispr