ID: 1164461340

View in Genome Browser
Species Human (GRCh38)
Location 19:28451413-28451435
Sequence TTTGTTAGGTCTTTTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164461334_1164461340 10 Left 1164461334 19:28451380-28451402 CCAGAAGGCCTTCACTTTTCTAA 0: 2
1: 6
2: 12
3: 64
4: 253
Right 1164461340 19:28451413-28451435 TTTGTTAGGTCTTTTTTCCATGG No data
1164461337_1164461340 2 Left 1164461337 19:28451388-28451410 CCTTCACTTTTCTAAAAGGGCAT No data
Right 1164461340 19:28451413-28451435 TTTGTTAGGTCTTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164461340 Original CRISPR TTTGTTAGGTCTTTTTTCCA TGG Intergenic
No off target data available for this crispr