ID: 1164463376

View in Genome Browser
Species Human (GRCh38)
Location 19:28467085-28467107
Sequence AGGTTTTAAAACCAGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164463376_1164463379 -5 Left 1164463376 19:28467085-28467107 CCCTGTGGCTGGTTTTAAAACCT No data
Right 1164463379 19:28467103-28467125 AACCTCTATATCGTGGAGTTTGG No data
1164463376_1164463380 -4 Left 1164463376 19:28467085-28467107 CCCTGTGGCTGGTTTTAAAACCT No data
Right 1164463380 19:28467104-28467126 ACCTCTATATCGTGGAGTTTGGG No data
1164463376_1164463382 6 Left 1164463376 19:28467085-28467107 CCCTGTGGCTGGTTTTAAAACCT No data
Right 1164463382 19:28467114-28467136 CGTGGAGTTTGGGATTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164463376 Original CRISPR AGGTTTTAAAACCAGCCACA GGG (reversed) Intergenic
No off target data available for this crispr