ID: 1164463378

View in Genome Browser
Species Human (GRCh38)
Location 19:28467096-28467118
Sequence GTTTTAAAACCTCTATATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164463372_1164463378 6 Left 1164463372 19:28467067-28467089 CCAATGCCATCGTGCACGCCCTG No data
Right 1164463378 19:28467096-28467118 GTTTTAAAACCTCTATATCGTGG No data
1164463374_1164463378 0 Left 1164463374 19:28467073-28467095 CCATCGTGCACGCCCTGTGGCTG No data
Right 1164463378 19:28467096-28467118 GTTTTAAAACCTCTATATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164463378 Original CRISPR GTTTTAAAACCTCTATATCG TGG Intergenic
No off target data available for this crispr