ID: 1164463380

View in Genome Browser
Species Human (GRCh38)
Location 19:28467104-28467126
Sequence ACCTCTATATCGTGGAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164463376_1164463380 -4 Left 1164463376 19:28467085-28467107 CCCTGTGGCTGGTTTTAAAACCT No data
Right 1164463380 19:28467104-28467126 ACCTCTATATCGTGGAGTTTGGG No data
1164463374_1164463380 8 Left 1164463374 19:28467073-28467095 CCATCGTGCACGCCCTGTGGCTG No data
Right 1164463380 19:28467104-28467126 ACCTCTATATCGTGGAGTTTGGG No data
1164463372_1164463380 14 Left 1164463372 19:28467067-28467089 CCAATGCCATCGTGCACGCCCTG No data
Right 1164463380 19:28467104-28467126 ACCTCTATATCGTGGAGTTTGGG No data
1164463377_1164463380 -5 Left 1164463377 19:28467086-28467108 CCTGTGGCTGGTTTTAAAACCTC No data
Right 1164463380 19:28467104-28467126 ACCTCTATATCGTGGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164463380 Original CRISPR ACCTCTATATCGTGGAGTTT GGG Intergenic
No off target data available for this crispr