ID: 1164470216

View in Genome Browser
Species Human (GRCh38)
Location 19:28523630-28523652
Sequence CTGTGCAAACAGTTGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164470213_1164470216 25 Left 1164470213 19:28523582-28523604 CCAGCAAAAGGGCAAGAATTTCT No data
Right 1164470216 19:28523630-28523652 CTGTGCAAACAGTTGATGTATGG No data
1164470215_1164470216 0 Left 1164470215 19:28523607-28523629 CCAGTCAGATTTCTGGCTTCTCT 0: 17
1: 25
2: 46
3: 88
4: 371
Right 1164470216 19:28523630-28523652 CTGTGCAAACAGTTGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164470216 Original CRISPR CTGTGCAAACAGTTGATGTA TGG Intergenic
No off target data available for this crispr