ID: 1164472932

View in Genome Browser
Species Human (GRCh38)
Location 19:28550819-28550841
Sequence CTAGTTTTCCAGATTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164472932_1164472936 -1 Left 1164472932 19:28550819-28550841 CCCAGAGAAATCTGGAAAACTAG No data
Right 1164472936 19:28550841-28550863 GTCCAGGCCATGATGGAAAAAGG No data
1164472932_1164472941 30 Left 1164472932 19:28550819-28550841 CCCAGAGAAATCTGGAAAACTAG No data
Right 1164472941 19:28550872-28550894 CATGCCTAGCTTTGGAGTTTAGG No data
1164472932_1164472940 22 Left 1164472932 19:28550819-28550841 CCCAGAGAAATCTGGAAAACTAG No data
Right 1164472940 19:28550864-28550886 GCATCAGACATGCCTAGCTTTGG No data
1164472932_1164472937 0 Left 1164472932 19:28550819-28550841 CCCAGAGAAATCTGGAAAACTAG No data
Right 1164472937 19:28550842-28550864 TCCAGGCCATGATGGAAAAAGGG No data
1164472932_1164472935 -8 Left 1164472932 19:28550819-28550841 CCCAGAGAAATCTGGAAAACTAG No data
Right 1164472935 19:28550834-28550856 AAAACTAGTCCAGGCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164472932 Original CRISPR CTAGTTTTCCAGATTTCTCT GGG (reversed) Intergenic
No off target data available for this crispr