ID: 1164479467

View in Genome Browser
Species Human (GRCh38)
Location 19:28600234-28600256
Sequence GTGACACAGCTGCAGCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164479467_1164479471 17 Left 1164479467 19:28600234-28600256 CCCCACTGCTGCAGCTGTGTCAC No data
Right 1164479471 19:28600274-28600296 TAATTCCTCTGCAAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164479467 Original CRISPR GTGACACAGCTGCAGCAGTG GGG (reversed) Intergenic
No off target data available for this crispr