ID: 1164481054

View in Genome Browser
Species Human (GRCh38)
Location 19:28611268-28611290
Sequence AAAGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164481048_1164481054 5 Left 1164481048 19:28611240-28611262 CCAAGTGCATGGGGCATTATACA 0: 5
1: 5
2: 13
3: 18
4: 93
Right 1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG No data
1164481044_1164481054 18 Left 1164481044 19:28611227-28611249 CCTTTTTAACTCTCCAAGTGCAT No data
Right 1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164481054 Original CRISPR AAAGGCCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr