ID: 1164481058

View in Genome Browser
Species Human (GRCh38)
Location 19:28611312-28611334
Sequence AGGGATCCTGCAATTATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 4, 2: 6, 3: 19, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164481055_1164481058 16 Left 1164481055 19:28611273-28611295 CCTATTGAACTCTGGGGGAAAAG 0: 30
1: 27
2: 17
3: 39
4: 172
Right 1164481058 19:28611312-28611334 AGGGATCCTGCAATTATTAGAGG 0: 1
1: 4
2: 6
3: 19
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164481058 Original CRISPR AGGGATCCTGCAATTATTAG AGG Intergenic
902930919 1:19730942-19730964 AGCTATCCTGCAATTAGGAGAGG + Intronic
902986632 1:20158498-20158520 AGAGATCCTGCAGTTAGTAGAGG + Intergenic
905902775 1:41592711-41592733 AGGCAACCTGCAATTGTTGGTGG + Intronic
906886096 1:49650679-49650701 AGGGATCCTGCAATTTTCCAAGG - Intronic
911193570 1:94972002-94972024 AGGGGTCCTGGAAATGTTAGGGG - Intergenic
915994275 1:160548193-160548215 AGGGAACCTGCCAGTATTGGTGG + Intronic
918299747 1:183192217-183192239 AGGGATCCTGCACTTATTCAGGG + Intronic
919566159 1:199191493-199191515 ATGGATCGTGAAATAATTAGTGG + Intergenic
920587483 1:207180966-207180988 GGGGATCCTGCAGTTATTCAGGG + Intergenic
1063875285 10:10470202-10470224 AGAGATCCTGTAATAATCAGGGG - Intergenic
1070271661 10:74962368-74962390 AGGGCTCCCGCCATTATTTGAGG - Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1083433111 11:62625181-62625203 AGAGCTGCTGCAATTCTTAGAGG - Exonic
1086678593 11:89640580-89640602 GGGAATCCTGCAATCATTAGAGG - Intergenic
1087034265 11:93740894-93740916 GGGGATTCTGCAATTCTTAGAGG + Intronic
1088548361 11:110984938-110984960 AGGGATCCTGCATTAATTAATGG + Intergenic
1089722796 11:120444557-120444579 AGAGATCTTACAATTTTTAGCGG + Intronic
1093289301 12:17301660-17301682 AGAGATCCTGCAACTATTAGAGG + Intergenic
1095320263 12:40818716-40818738 AAAGATGCTGCAATTATTTGGGG + Intronic
1095469637 12:42522825-42522847 AGGGATCTAGGAATTTTTAGTGG + Intronic
1095824937 12:46521036-46521058 CAGGATTCTGCCATTATTAGAGG - Intergenic
1097071234 12:56356361-56356383 CGGGATCCTGGAATCATTAATGG - Intronic
1097732538 12:63145682-63145704 AGAGATCATGCAATGATTTGAGG - Exonic
1097982895 12:65752351-65752373 GTGAATCCTGCAATTATGAGGGG - Intergenic
1098614145 12:72501987-72502009 AGAGATGCTGCAGTTATTAAAGG - Intronic
1100099940 12:91091451-91091473 AGGGCTGCTGCAGTTATTTGGGG + Intergenic
1103174053 12:118846391-118846413 ATGGCTTCTGCCATTATTAGAGG + Intergenic
1104292913 12:127485628-127485650 AGAGATCTTGCAATTATTAGAGG + Intergenic
1109803006 13:67401973-67401995 AGAAATTCTACAATTATTAGAGG + Intergenic
1111964466 13:94846974-94846996 TAGGATGCTGCAATTAGTAGAGG - Intergenic
1120644677 14:87059388-87059410 AGGAAACCAGCAATTATTAGGGG - Intergenic
1127096300 15:55515045-55515067 AGAAATTCTACAATTATTAGAGG - Intergenic
1140021382 16:71242319-71242341 AGGGATACCGTAATTATCAGAGG - Intergenic
1145125543 17:20297107-20297129 AGGACTCCTGCATTTCTTAGAGG - Intronic
1148204437 17:45771092-45771114 AGGGATTCTGCAATTCACAGTGG + Intergenic
1149076128 17:52597562-52597584 AGAGATCCTGCAATTATTAGAGG + Intergenic
1158728282 18:59994928-59994950 AGGGAGCCTAAAGTTATTAGTGG + Intergenic
1162207957 19:9070199-9070221 AGGGTTCCTGCATTCCTTAGGGG - Intergenic
1162284201 19:9726066-9726088 AGATATTCTACAATTATTAGAGG - Intergenic
1163916792 19:20247143-20247165 AGAAATCTTGCAATTATTAGAGG + Intergenic
1164481058 19:28611312-28611334 AGGGATCCTGCAATTATTAGAGG + Intergenic
1167034292 19:46984796-46984818 AGCGATCTGGCAATTATCAGTGG - Intronic
1167843871 19:52144127-52144149 AGGGATCCTCCACATATTGGTGG - Intergenic
926611521 2:14952775-14952797 AGGAATTCTGCAAATATTACTGG - Intergenic
928200188 2:29242957-29242979 AGGACTCCTGCAATTATTTCAGG - Intronic
929948394 2:46387932-46387954 TGGGACCCTGCAGTTGTTAGGGG - Intergenic
930518556 2:52435565-52435587 AGAGGTCCTGCAATTATTAGAGG + Intergenic
932088801 2:68786512-68786534 AGGGATATTGCAATTCCTAGAGG + Intronic
937942853 2:127301089-127301111 AGGGATTCAGAAATTATTTGGGG + Exonic
947987916 2:234464803-234464825 AAGGATCCTACAAGGATTAGAGG - Intergenic
1168973160 20:1944873-1944895 AGGCACCCAGCAAATATTAGAGG + Intergenic
1169971378 20:11272279-11272301 AGGGATCCTCTAATTATGGGTGG - Intergenic
1177068161 21:16465672-16465694 ATGAATCCTTCAAATATTAGTGG - Intergenic
1178447719 21:32660837-32660859 AGAAATTCTACAATTATTAGAGG + Intronic
1179082047 21:38180254-38180276 TGGGATCCTGCCAATTTTAGAGG + Intronic
949158120 3:851199-851221 AGAGATTCTGCAATTATTAGAGG + Intergenic
949852416 3:8432729-8432751 AAGGATTATTCAATTATTAGAGG - Intergenic
951166004 3:19485840-19485862 AGAAATTCTACAATTATTAGAGG - Intronic
954842703 3:53526003-53526025 AGCCATCCTGCAATTACAAGGGG - Intronic
956796205 3:72720915-72720937 ATGGACACTGCAATGATTAGAGG + Intergenic
957022503 3:75141001-75141023 AGAGATCCTGCAACTATTAGAGG + Intergenic
958689262 3:97441770-97441792 AGTGAACATGCAATTATCAGTGG - Intronic
960316498 3:116184732-116184754 TGGGATCCTGCTATATTTAGGGG + Intronic
964522392 3:157583148-157583170 AGAAATTCTACAATTATTAGAGG - Intronic
965870565 3:173259665-173259687 AGGGATGAAGAAATTATTAGTGG - Intergenic
970546861 4:17138700-17138722 AATGATTCTGAAATTATTAGAGG - Intergenic
971424519 4:26502943-26502965 AGGCATCCTCCACTTATTTGTGG + Intergenic
974494514 4:62609283-62609305 AAGTATCCAGCAATTACTAGAGG - Intergenic
976970023 4:91092950-91092972 AGAAATTCTACAATTATTAGAGG - Intronic
977435191 4:96986486-96986508 AAGGAACCTGCAATGATTAAGGG - Intergenic
978327247 4:107573483-107573505 CTAGATCCTGCAAATATTAGGGG - Intergenic
984821636 4:183887681-183887703 CTGGATCTTGCACTTATTAGAGG - Intronic
990616154 5:57510684-57510706 AGGGATTCTGCAATAGTTAGGGG - Intergenic
994443270 5:99837324-99837346 AGTGATCCTGAAATAATTAGGGG - Intergenic
995854281 5:116576049-116576071 AGGGAACGTGGACTTATTAGTGG - Intergenic
996375527 5:122802684-122802706 AGGGACACTGCAATGATTAAAGG + Intronic
1001518101 5:172371289-172371311 AGAGATCATGCAATTATTTGAGG - Intronic
1002408127 5:179052376-179052398 AGAAATTCTGCAATTATTAGAGG - Intergenic
1005029178 6:21493443-21493465 AGAGTTCCTGCAATTATGCGGGG - Intergenic
1007905487 6:45455788-45455810 AGAGAAACTGCAATTATTATTGG + Intronic
1008903690 6:56652810-56652832 AGTGACCCTACAATTATTATAGG + Intronic
1012611687 6:101227089-101227111 AGAGATCCTGCAATTGTTAGAGG - Intergenic
1012684287 6:102225079-102225101 AGTGATTCTCCAATTCTTAGTGG + Intergenic
1013364513 6:109425828-109425850 AGGGGTCCTGTTAATATTAGGGG - Intronic
1013575030 6:111474421-111474443 AGGGATCATGGAATTGTTACTGG - Intronic
1017737497 6:157378766-157378788 AGGGAACCTGCAATTCCTAGAGG - Intergenic
1025147230 7:56515319-56515341 AGAGATCCTGGAATTATTGGAGG + Intergenic
1026319139 7:69253790-69253812 AGAGATCCTGGAACTATTGGAGG - Intergenic
1030739987 7:113097657-113097679 AGGCATTCAGCAATTATTAGTGG + Intergenic
1032170778 7:129582887-129582909 AGAGATCCTGCAATTATTAGAGG + Intergenic
1036211031 8:6841512-6841534 GGGGACCCTGCAATTGTGAGGGG + Intergenic
1037187255 8:16079015-16079037 AGAGATCCTGCAAATGATAGAGG + Intergenic
1038412527 8:27369242-27369264 AGGGATCCTGTGATTATAAGAGG - Intronic
1039278391 8:35956330-35956352 AGAGATCTTGCAATTATTGGAGG + Intergenic
1041145128 8:54867596-54867618 AAGTGTCCTGCAATTATTAGAGG + Intergenic
1043570943 8:81601707-81601729 AGGGATATTGAAATTATTTGTGG + Intergenic
1044205030 8:89483697-89483719 AGGGATCTTGCAATCATTTCTGG - Intergenic
1048721101 8:137326293-137326315 AGGCATCCAGTAATTATGAGAGG - Intergenic
1058234813 9:102476580-102476602 AGGGATGCTGCAAGGACTAGAGG + Intergenic
1059974232 9:119698629-119698651 ATGGATCCTGCAAAGATCAGGGG - Intergenic
1185777607 X:2817526-2817548 AGGGATTCTGCAGTTATATGAGG + Intergenic
1188519711 X:31024891-31024913 AAGGAACCTGAAATTCTTAGAGG + Intergenic
1189194268 X:39139273-39139295 AGGGATCCTGCACCTAGGAGTGG - Intergenic
1190314769 X:49143443-49143465 AGAGATCCTGCAATTATTAGAGG - Intergenic
1191036030 X:56027385-56027407 AGAAATTCTACAATTATTAGAGG - Intergenic
1192852071 X:74967481-74967503 AGGGATTCTGAAGATATTAGTGG + Intergenic
1198557918 X:137815660-137815682 AGGGATGCTGCAAACTTTAGGGG + Intergenic
1198970077 X:142269995-142270017 AGAAATTCTGCAATTATTAGAGG + Intergenic
1201270356 Y:12248053-12248075 AGAAATTCTGCAATTATTAGAGG + Intergenic
1202037307 Y:20648034-20648056 AGAGATCCTGCAATTATTAGAGG + Intergenic