ID: 1164483691

View in Genome Browser
Species Human (GRCh38)
Location 19:28636666-28636688
Sequence TTGTAGATAGAGATTGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164483687_1164483691 -3 Left 1164483687 19:28636646-28636668 CCAGGTCAAAAGCCTTCATCTTG No data
Right 1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164483691 Original CRISPR TTGTAGATAGAGATTGAGAG GGG Intergenic
No off target data available for this crispr