ID: 1164485822

View in Genome Browser
Species Human (GRCh38)
Location 19:28654966-28654988
Sequence AGAGCACTGCATGGGCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164485822_1164485838 30 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485838 19:28655019-28655041 GGAGGATGCCCCAGAACTAGGGG No data
1164485822_1164485836 28 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485836 19:28655017-28655039 GGGGAGGATGCCCCAGAACTAGG No data
1164485822_1164485832 7 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485832 19:28654996-28655018 AGGGAGCAGGCATAGCACAGAGG No data
1164485822_1164485834 9 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485834 19:28654998-28655020 GGAGCAGGCATAGCACAGAGGGG No data
1164485822_1164485837 29 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485837 19:28655018-28655040 GGGAGGATGCCCCAGAACTAGGG No data
1164485822_1164485835 12 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485835 19:28655001-28655023 GCAGGCATAGCACAGAGGGGAGG No data
1164485822_1164485830 -6 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485830 19:28654983-28655005 TGCTCTACAATCCAGGGAGCAGG No data
1164485822_1164485833 8 Left 1164485822 19:28654966-28654988 CCCCCGAGCCCATGCAGTGCTCT No data
Right 1164485833 19:28654997-28655019 GGGAGCAGGCATAGCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164485822 Original CRISPR AGAGCACTGCATGGGCTCGG GGG (reversed) Intergenic
No off target data available for this crispr