ID: 1164487702

View in Genome Browser
Species Human (GRCh38)
Location 19:28674637-28674659
Sequence CCAGATAATCCCTTGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164487694_1164487702 27 Left 1164487694 19:28674587-28674609 CCCTGTCCTAGAATAAAATTTCT No data
Right 1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG No data
1164487698_1164487702 1 Left 1164487698 19:28674613-28674635 CCTTGGTGCTACTGACATTTTGA No data
Right 1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG No data
1164487696_1164487702 21 Left 1164487696 19:28674593-28674615 CCTAGAATAAAATTTCTCTACCT No data
Right 1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG No data
1164487695_1164487702 26 Left 1164487695 19:28674588-28674610 CCTGTCCTAGAATAAAATTTCTC No data
Right 1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164487702 Original CRISPR CCAGATAATCCCTTGTTGTG GGG Intergenic
No off target data available for this crispr