ID: 1164487846

View in Genome Browser
Species Human (GRCh38)
Location 19:28676417-28676439
Sequence ATAGTCCTTCTGGTCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164487839_1164487846 29 Left 1164487839 19:28676365-28676387 CCCTAGTCATTAGTAGGAAAAAC No data
Right 1164487846 19:28676417-28676439 ATAGTCCTTCTGGTCAAATTTGG No data
1164487838_1164487846 30 Left 1164487838 19:28676364-28676386 CCCCTAGTCATTAGTAGGAAAAA No data
Right 1164487846 19:28676417-28676439 ATAGTCCTTCTGGTCAAATTTGG No data
1164487840_1164487846 28 Left 1164487840 19:28676366-28676388 CCTAGTCATTAGTAGGAAAAACA No data
Right 1164487846 19:28676417-28676439 ATAGTCCTTCTGGTCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164487846 Original CRISPR ATAGTCCTTCTGGTCAAATT TGG Intergenic
No off target data available for this crispr