ID: 1164490603

View in Genome Browser
Species Human (GRCh38)
Location 19:28709660-28709682
Sequence TAGGGGTCTGAAGATGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164490603_1164490607 10 Left 1164490603 19:28709660-28709682 CCAACATCATCTTCAGACCCCTA No data
Right 1164490607 19:28709693-28709715 TAGTGTGTTTTGAATTAGAAAGG No data
1164490603_1164490608 29 Left 1164490603 19:28709660-28709682 CCAACATCATCTTCAGACCCCTA No data
Right 1164490608 19:28709712-28709734 AAGGAAAAATATTTGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164490603 Original CRISPR TAGGGGTCTGAAGATGATGT TGG (reversed) Intergenic
No off target data available for this crispr