ID: 1164493705

View in Genome Browser
Species Human (GRCh38)
Location 19:28737925-28737947
Sequence AGTTTCACCCTAGTAACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164493705_1164493709 23 Left 1164493705 19:28737925-28737947 CCACATGTTACTAGGGTGAAACT No data
Right 1164493709 19:28737971-28737993 ACGATGACCACAACTCACACAGG No data
1164493705_1164493710 24 Left 1164493705 19:28737925-28737947 CCACATGTTACTAGGGTGAAACT No data
Right 1164493710 19:28737972-28737994 CGATGACCACAACTCACACAGGG No data
1164493705_1164493712 29 Left 1164493705 19:28737925-28737947 CCACATGTTACTAGGGTGAAACT No data
Right 1164493712 19:28737977-28737999 ACCACAACTCACACAGGGATGGG No data
1164493705_1164493711 28 Left 1164493705 19:28737925-28737947 CCACATGTTACTAGGGTGAAACT No data
Right 1164493711 19:28737976-28737998 GACCACAACTCACACAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164493705 Original CRISPR AGTTTCACCCTAGTAACATG TGG (reversed) Intergenic